empty vector expression plasmid Search Results


93
Addgene inc pet
Pet, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet/product/Addgene inc
Average 93 stars, based on 1 article reviews
pet - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

95
Addgene inc taggcaccatggtccactgcag mythdf1 e4
Taggcaccatggtccactgcag Mythdf1 E4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taggcaccatggtccactgcag mythdf1 e4/product/Addgene inc
Average 95 stars, based on 1 article reviews
taggcaccatggtccactgcag mythdf1 e4 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

93
Addgene inc 12urab
12urab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/12urab/product/Addgene inc
Average 93 stars, based on 1 article reviews
12urab - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Addgene inc gfp
Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
gfp - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

92
Addgene inc plex cas9 addgene
Plex Cas9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plex cas9 addgene/product/Addgene inc
Average 92 stars, based on 1 article reviews
plex cas9 addgene - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

93
Addgene inc ecori restriction sites
Ecori Restriction Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ecori restriction sites/product/Addgene inc
Average 93 stars, based on 1 article reviews
ecori restriction sites - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Addgene inc luciferase vector ori empty plasmid
Luciferase Vector Ori Empty Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luciferase vector ori empty plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
luciferase vector ori empty plasmid - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

91
Addgene inc pet his6 sumo vector
Pet His6 Sumo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet his6 sumo vector/product/Addgene inc
Average 91 stars, based on 1 article reviews
pet his6 sumo vector - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier

93
Addgene inc gall 10 his6 mbp tev ura s cerevisiae expression vector
Gall 10 His6 Mbp Tev Ura S Cerevisiae Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gall 10 his6 mbp tev ura s cerevisiae expression vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
gall 10 his6 mbp tev ura s cerevisiae expression vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

91
Addgene inc lentiviral gfp cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Lentiviral Gfp Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral gfp cre empty vector/product/Addgene inc
Average 91 stars, based on 1 article reviews
lentiviral gfp cre empty vector - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier

93
Addgene inc puro cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Puro Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/puro cre empty vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
puro cre empty vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Addgene inc luc cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Luc Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luc cre empty vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
luc cre empty vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing lentiviral vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.

Journal: bioRxiv

Article Title: MCC950/CRID3 potently targets the NACHT domain of wildtype NLRP3 but not disease-associated mutants for inflammasome inhibition

doi: 10.1101/634493

Figure Lengend Snippet: (A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing lentiviral vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.

Article Snippet: To induce lentivirus production, the lentiviral GFP.Cre empty vector (20781, Addgene) together with 2 nd generation packaging vector psPAX2 (12260, Addgene) and VSV-G-expressing envelope plasmid pCMV-VSV-G (8454, Addgene) were transfected into HEK293 T cells using jetPRIME transfection reagent (114-15, PolyPlus Transfect).

Techniques: Transduction, Expressing, Plasmid Preparation