empty vector expression plasmid Search Results


pet  (Addgene inc)
93
Addgene inc pet
Pet, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet/product/Addgene inc
Average 93 stars, based on 1 article reviews
pet - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
taggcaccatggtccactgcag mythdf1 e4  (Addgene inc)
95
Addgene inc taggcaccatggtccactgcag mythdf1 e4
Taggcaccatggtccactgcag Mythdf1 E4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taggcaccatggtccactgcag mythdf1 e4/product/Addgene inc
Average 95 stars, based on 1 article reviews
taggcaccatggtccactgcag mythdf1 e4 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier
12urab  (Addgene inc)
93
Addgene inc 12urab
12urab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/12urab/product/Addgene inc
Average 93 stars, based on 1 article reviews
12urab - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
gfp  (Addgene inc)
93
Addgene inc gfp
Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
gfp - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
plex cas9 addgene  (Addgene inc)
92
Addgene inc plex cas9 addgene
Plex Cas9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plex cas9 addgene/product/Addgene inc
Average 92 stars, based on 1 article reviews
plex cas9 addgene - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier
ecori restriction sites  (Addgene inc)
93
Addgene inc ecori restriction sites
Ecori Restriction Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ecori restriction sites/product/Addgene inc
Average 93 stars, based on 1 article reviews
ecori restriction sites - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
luciferase vector ori empty plasmid  (Addgene inc)
93
Addgene inc luciferase vector ori empty plasmid
Luciferase Vector Ori Empty Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luciferase vector ori empty plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
luciferase vector ori empty plasmid - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
pet his6 sumo vector  (Addgene inc)
91
Addgene inc pet his6 sumo vector
Pet His6 Sumo Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet his6 sumo vector/product/Addgene inc
Average 91 stars, based on 1 article reviews
pet his6 sumo vector - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier
gall 10 his6 mbp tev ura s cerevisiae expression vector  (Addgene inc)
93
Addgene inc gall 10 his6 mbp tev ura s cerevisiae expression vector
Gall 10 His6 Mbp Tev Ura S Cerevisiae Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gall 10 his6 mbp tev ura s cerevisiae expression vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
gall 10 his6 mbp tev ura s cerevisiae expression vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
lentiviral gfp cre empty vector  (Addgene inc)
91
Addgene inc lentiviral gfp cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Lentiviral Gfp Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral gfp cre empty vector/product/Addgene inc
Average 91 stars, based on 1 article reviews
lentiviral gfp cre empty vector - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier
puro cre empty vector  (Addgene inc)
93
Addgene inc puro cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Puro Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/puro cre empty vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
puro cre empty vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
luc cre empty vector  (Addgene inc)
93
Addgene inc luc cre empty vector
(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing <t>lentiviral</t> vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.
Luc Cre Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luc cre empty vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
luc cre empty vector - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


(A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing lentiviral vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.

Journal: bioRxiv

Article Title: MCC950/CRID3 potently targets the NACHT domain of wildtype NLRP3 but not disease-associated mutants for inflammasome inhibition

doi: 10.1101/634493

Figure Lengend Snippet: (A-F) Wild type (A- B), Nlrp3 L351P/L351P (C-D) or Nlrp3 A350V/A350V (E-F) BMDMs that were transduced with a Cre-recombinase expressing lentiviral vector, were left unstimulated (Ctrl) or stimulated with LPS and then left untreated or treated with ATP or nigericin (Nig) in absence or presence of MCC950/CRID3. Supernatants was analyzed for IL-1β (A,C,E) and IL-18 (B,D,F) secretion. Graphs show mean ± s.d. of triplicate wells and represent three independent experiments.

Article Snippet: To induce lentivirus production, the lentiviral GFP.Cre empty vector (20781, Addgene) together with 2 nd generation packaging vector psPAX2 (12260, Addgene) and VSV-G-expressing envelope plasmid pCMV-VSV-G (8454, Addgene) were transfected into HEK293 T cells using jetPRIME transfection reagent (114-15, PolyPlus Transfect).

Techniques: Transduction, Expressing, Plasmid Preparation